|
|
Emerging
Infectious Disease
D. EpidemiologyThe
Village of New Mona 1 Would you declare the situation in New Mona an outbreak? 2 What additional information do you need? Will your study be prospective or retrospective? You are able to interview 28 case-patients and 56 healthy controls. (Another 10 patients have been hospitalized and 4 more deaths have occurred.) All of the patients work in the same office building. You select 56 controls from the same office building.
*Construct a 2 x 2 table to determine relative risk
3 Which exposure suggests an association with pneumonia? Identifying the Cause Kary Mullis received the Nobel Prize in 1993 for developing the polymerase chain reaction (PCR). PCR has revolutionized medicine and the biological sciences. PCR is a technique by which small samples of DNA can be quickly increased to quantities that are large enough for analysis. Each strain of the target DNA serves as a template for DNA synthesis. To this DNA is added a supply of DNA components and the enzyme that makes DNA, DNA polymerase. Short pieces of nucleic acid called primers are also added to start the reaction. The primers are complementary to the target DNA and will hybridize to the fragments to be amplified. This technique has been used to identify perpetrators from hair and body fluids left at a crime scene, to classify living organisms, and to classify and identify bacteria that lived 40,000 years ago. In a medical lab when a microbe cannot be cultured by conventional methods, the causative agent of an infectious disease might not be recognized. PCR can be used to identify these microbes. In 1993, PCR was used to identify Hantavirus as the causative agent of a hemorrhagic disease in the American southwest in record timeless than two weeks. Your
task is to use PCR to identify the cause of the disease. There are
thousands of known bacteria and viruses. Select a primer for your
PCR. The usual suspects are: Bacteria (Streptococcus pneumoniae**,
Haemophilus influenzae**, Mycoplasma pneumoniae**,
Chlamydia pneumoniae, Chlamydia psittaci, Coxiella
burnetti, Staphylococcus aureus**, Streptococcus
pyogenes**), Respiratory syncytial virus, and Pneumocystis
carinii fungus. The microbes DNA: AAAATCGGCAAATACCATTATTACCGAAATCGGCAATTGGCGTAA Primers:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Back to top |